Multi Omics Browser (M.O.B) allows researchers to search for FORC DB genes that have highest similarity with the genes of interest. It also provides a list of strains that harbor the genes, taxonomic analysis results, and available quantitative expression data.

Please input a nucleotide sequence of your interest.

An example sequence is as below:

AAAGCGGATTATGCAGAAGCACTGATTCGTTTGACGGACGCAGGTGCGAAG
AACTTCATGTTGATGACACTGCCAGACGCGACGAAAGCGCCTCAGTTTAAG
TACTCAACACAAGAAGAGATCGACAAAATTCGTGCGAAAGTGCTTGAGATG
AACGAGTTCATCAAGGCACAAGCGATGTACTACAAAGCGCAAGGTTACAAC
ATCACGTTGTTTGATACTCACGCCTTGTTCGAGACGCTAACTTCTGCGCCA
GAAGAGCACGGTTTCGTGAACGCGAGTGATCCTTGTTTGGACATCAACCGC
TCATCGTCTGTCGATTACATGTACACCCACGCATTGCGCTCTGAGTGTGCG
GCGTCTGGTGCTGAGAAGTTTGTGTTCTGGGATGTCACGCACCCAACAACA
GCAACTCACCGCTATGTCGCAGAGAAAATGCTAGAAAGTAGCA

Input your sequence data